shRNA:Article Title: Therapeutic stress triggers tumor STAT1 acetylation to disarm immunotherapy.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER CAL27-Cetuximab-resistant cell This paper N/A MOC-L2 Dr. Kuo-Wei Chang (National Yang Ming Chiao Tung University of Taiwan) Chen et al. 31 MOC-L2-1 This paper N/A FaDu were originally from ATCC Cat# HTB-43 TM SAS were originally from AcceGen Cat# ABL-TC0611 HSC-3 were originally from AcceGen Cat# ABL-TC0290 Experimental models: Organisms/strains Mouse:C57BL/6JNarl National Laboratory Animal Center (NLAC, Taiwan) https://www.nlac.narl.org.tw/eng/ index.asp Oligonucleotides Short hairpin RNA against mouse STAT1 CCGGGGACTAGAGTGCGAGTATTTGCT CGAGCAAATACTCGCACTCTAGTCCTT TTTG National RNAi Core Facility, Academia Sinica, Taiwan https://rnai.genmed.sinica. edu.tw/?wicket:interface=:2:rnaiHome:: ILinkListener TRCN0000235837 Primers for quantitative PCR, see Table S14 This paper N/A Short hairpin RNA against mouse STAT1 CCGGCCGAAGAACTTCACTCTCTTAC TCGAGTAAGAGAGTGAAGTTCTTCGG TTTTTG National RNAi Core Facility, Academia Sinica, Taiwan https://rnai.genmed.sinica. edu.tw/?wicket:interface=:2:rnaiHome:: ILinkListener TRCN0000235837 Recombinant DNA pLV-WT-STAT1 Cheon et al. 45 Cat#71454 RRID:Addgene_71454 http:// n2t.net/addgene:71454 pLV-Y701F-STAT1 This paper N/A pLV-S727A-STAT1 This paper N/A pLV-K637R-STAT1 This paper N/A pLV-K637Q-STAT1 This paper N/A Software and algorithms ImageJv1.53e Schneider et al., 2012 46 https://imagej.net/ij/list.html Ingenuity Pathway Analysis (IPA) QIAGEN https://digitalinsights.qiagen.com/ GraphPad Prism 8 GraphPad Software, San Diego, CA https://www.graphpad.com/ DAVID Bioinformatics Resources 6.8 LHRI (Huang et al., 2009) 47 https://david.ncifcrf.gov/ Gene Set Enrichment Analysis (GSEA) UC San Diego and Broad Institute (Subramanian et al., 2005) 48 https://www.gsea-msigdb.org/gsea/ index.jsp e5 Cell Reports Medicine 6, 102448, November 18, 2025 OPEN ACCESS immunotherapy (cetuximab-resistant group, n = 35), and (b) patients treated with immunotherapy without prior cetuximab exposure (cetuximab-naı̈ve group, n = 54). ..
Real-time Polymerase Chain Reaction:Article Title: Therapeutic stress triggers tumor STAT1 acetylation to disarm immunotherapy.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER CAL27-Cetuximab-resistant cell This paper N/A MOC-L2 Dr. Kuo-Wei Chang (National Yang Ming Chiao Tung University of Taiwan) Chen et al. 31 MOC-L2-1 This paper N/A FaDu were originally from ATCC Cat# HTB-43 TM SAS were originally from AcceGen Cat# ABL-TC0611 HSC-3 were originally from AcceGen Cat# ABL-TC0290 Experimental models: Organisms/strains Mouse:C57BL/6JNarl National Laboratory Animal Center (NLAC, Taiwan) https://www.nlac.narl.org.tw/eng/ index.asp Oligonucleotides Short hairpin RNA against mouse STAT1 CCGGGGACTAGAGTGCGAGTATTTGCT CGAGCAAATACTCGCACTCTAGTCCTT TTTG National RNAi Core Facility, Academia Sinica, Taiwan https://rnai.genmed.sinica. edu.tw/?wicket:interface=:2:rnaiHome:: ILinkListener TRCN0000235837 Primers for quantitative PCR, see Table S14 This paper N/A Short hairpin RNA against mouse STAT1 CCGGCCGAAGAACTTCACTCTCTTAC TCGAGTAAGAGAGTGAAGTTCTTCGG TTTTTG National RNAi Core Facility, Academia Sinica, Taiwan https://rnai.genmed.sinica. edu.tw/?wicket:interface=:2:rnaiHome:: ILinkListener TRCN0000235837 Recombinant DNA pLV-WT-STAT1 Cheon et al. 45 Cat#71454 RRID:Addgene_71454 http:// n2t.net/addgene:71454 pLV-Y701F-STAT1 This paper N/A pLV-S727A-STAT1 This paper N/A pLV-K637R-STAT1 This paper N/A pLV-K637Q-STAT1 This paper N/A Software and algorithms ImageJv1.53e Schneider et al., 2012 46 https://imagej.net/ij/list.html Ingenuity Pathway Analysis (IPA) QIAGEN https://digitalinsights.qiagen.com/ GraphPad Prism 8 GraphPad Software, San Diego, CA https://www.graphpad.com/ DAVID Bioinformatics Resources 6.8 LHRI (Huang et al., 2009) 47 https://david.ncifcrf.gov/ Gene Set Enrichment Analysis (GSEA) UC San Diego and Broad Institute (Subramanian et al., 2005) 48 https://www.gsea-msigdb.org/gsea/ index.jsp e5 Cell Reports Medicine 6, 102448, November 18, 2025 OPEN ACCESS immunotherapy (cetuximab-resistant group, n = 35), and (b) patients treated with immunotherapy without prior cetuximab exposure (cetuximab-naı̈ve group, n = 54). ..
Recombinant:Article Title: Therapeutic stress triggers tumor STAT1 acetylation to disarm immunotherapy.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER CAL27-Cetuximab-resistant cell This paper N/A MOC-L2 Dr. Kuo-Wei Chang (National Yang Ming Chiao Tung University of Taiwan) Chen et al. 31 MOC-L2-1 This paper N/A FaDu were originally from ATCC Cat# HTB-43 TM SAS were originally from AcceGen Cat# ABL-TC0611 HSC-3 were originally from AcceGen Cat# ABL-TC0290 Experimental models: Organisms/strains Mouse:C57BL/6JNarl National Laboratory Animal Center (NLAC, Taiwan) https://www.nlac.narl.org.tw/eng/ index.asp Oligonucleotides Short hairpin RNA against mouse STAT1 CCGGGGACTAGAGTGCGAGTATTTGCT CGAGCAAATACTCGCACTCTAGTCCTT TTTG National RNAi Core Facility, Academia Sinica, Taiwan https://rnai.genmed.sinica. edu.tw/?wicket:interface=:2:rnaiHome:: ILinkListener TRCN0000235837 Primers for quantitative PCR, see Table S14 This paper N/A Short hairpin RNA against mouse STAT1 CCGGCCGAAGAACTTCACTCTCTTAC TCGAGTAAGAGAGTGAAGTTCTTCGG TTTTTG National RNAi Core Facility, Academia Sinica, Taiwan https://rnai.genmed.sinica. edu.tw/?wicket:interface=:2:rnaiHome:: ILinkListener TRCN0000235837 Recombinant DNA pLV-WT-STAT1 Cheon et al. 45 Cat#71454 RRID:Addgene_71454 http:// n2t.net/addgene:71454 pLV-Y701F-STAT1 This paper N/A pLV-S727A-STAT1 This paper N/A pLV-K637R-STAT1 This paper N/A pLV-K637Q-STAT1 This paper N/A Software and algorithms ImageJv1.53e Schneider et al., 2012 46 https://imagej.net/ij/list.html Ingenuity Pathway Analysis (IPA) QIAGEN https://digitalinsights.qiagen.com/ GraphPad Prism 8 GraphPad Software, San Diego, CA https://www.graphpad.com/ DAVID Bioinformatics Resources 6.8 LHRI (Huang et al., 2009) 47 https://david.ncifcrf.gov/ Gene Set Enrichment Analysis (GSEA) UC San Diego and Broad Institute (Subramanian et al., 2005) 48 https://www.gsea-msigdb.org/gsea/ index.jsp e5 Cell Reports Medicine 6, 102448, November 18, 2025 OPEN ACCESS immunotherapy (cetuximab-resistant group, n = 35), and (b) patients treated with immunotherapy without prior cetuximab exposure (cetuximab-naı̈ve group, n = 54). ..
Software:Article Title: Therapeutic stress triggers tumor STAT1 acetylation to disarm immunotherapy.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER CAL27-Cetuximab-resistant cell This paper N/A MOC-L2 Dr. Kuo-Wei Chang (National Yang Ming Chiao Tung University of Taiwan) Chen et al. 31 MOC-L2-1 This paper N/A FaDu were originally from ATCC Cat# HTB-43 TM SAS were originally from AcceGen Cat# ABL-TC0611 HSC-3 were originally from AcceGen Cat# ABL-TC0290 Experimental models: Organisms/strains Mouse:C57BL/6JNarl National Laboratory Animal Center (NLAC, Taiwan) https://www.nlac.narl.org.tw/eng/ index.asp Oligonucleotides Short hairpin RNA against mouse STAT1 CCGGGGACTAGAGTGCGAGTATTTGCT CGAGCAAATACTCGCACTCTAGTCCTT TTTG National RNAi Core Facility, Academia Sinica, Taiwan https://rnai.genmed.sinica. edu.tw/?wicket:interface=:2:rnaiHome:: ILinkListener TRCN0000235837 Primers for quantitative PCR, see Table S14 This paper N/A Short hairpin RNA against mouse STAT1 CCGGCCGAAGAACTTCACTCTCTTAC TCGAGTAAGAGAGTGAAGTTCTTCGG TTTTTG National RNAi Core Facility, Academia Sinica, Taiwan https://rnai.genmed.sinica. edu.tw/?wicket:interface=:2:rnaiHome:: ILinkListener TRCN0000235837 Recombinant DNA pLV-WT-STAT1 Cheon et al. 45 Cat#71454 RRID:Addgene_71454 http:// n2t.net/addgene:71454 pLV-Y701F-STAT1 This paper N/A pLV-S727A-STAT1 This paper N/A pLV-K637R-STAT1 This paper N/A pLV-K637Q-STAT1 This paper N/A Software and algorithms ImageJv1.53e Schneider et al., 2012 46 https://imagej.net/ij/list.html Ingenuity Pathway Analysis (IPA) QIAGEN https://digitalinsights.qiagen.com/ GraphPad Prism 8 GraphPad Software, San Diego, CA https://www.graphpad.com/ DAVID Bioinformatics Resources 6.8 LHRI (Huang et al., 2009) 47 https://david.ncifcrf.gov/ Gene Set Enrichment Analysis (GSEA) UC San Diego and Broad Institute (Subramanian et al., 2005) 48 https://www.gsea-msigdb.org/gsea/ index.jsp e5 Cell Reports Medicine 6, 102448, November 18, 2025 OPEN ACCESS immunotherapy (cetuximab-resistant group, n = 35), and (b) patients treated with immunotherapy without prior cetuximab exposure (cetuximab-naı̈ve group, n = 54). ..
Indirect Immunoperoxidase Assay:Article Title: Therapeutic stress triggers tumor STAT1 acetylation to disarm immunotherapy.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER CAL27-Cetuximab-resistant cell This paper N/A MOC-L2 Dr. Kuo-Wei Chang (National Yang Ming Chiao Tung University of Taiwan) Chen et al. 31 MOC-L2-1 This paper N/A FaDu were originally from ATCC Cat# HTB-43 TM SAS were originally from AcceGen Cat# ABL-TC0611 HSC-3 were originally from AcceGen Cat# ABL-TC0290 Experimental models: Organisms/strains Mouse:C57BL/6JNarl National Laboratory Animal Center (NLAC, Taiwan) https://www.nlac.narl.org.tw/eng/ index.asp Oligonucleotides Short hairpin RNA against mouse STAT1 CCGGGGACTAGAGTGCGAGTATTTGCT CGAGCAAATACTCGCACTCTAGTCCTT TTTG National RNAi Core Facility, Academia Sinica, Taiwan https://rnai.genmed.sinica. edu.tw/?wicket:interface=:2:rnaiHome:: ILinkListener TRCN0000235837 Primers for quantitative PCR, see Table S14 This paper N/A Short hairpin RNA against mouse STAT1 CCGGCCGAAGAACTTCACTCTCTTAC TCGAGTAAGAGAGTGAAGTTCTTCGG TTTTTG National RNAi Core Facility, Academia Sinica, Taiwan https://rnai.genmed.sinica. edu.tw/?wicket:interface=:2:rnaiHome:: ILinkListener TRCN0000235837 Recombinant DNA pLV-WT-STAT1 Cheon et al. 45 Cat#71454 RRID:Addgene_71454 http:// n2t.net/addgene:71454 pLV-Y701F-STAT1 This paper N/A pLV-S727A-STAT1 This paper N/A pLV-K637R-STAT1 This paper N/A pLV-K637Q-STAT1 This paper N/A Software and algorithms ImageJv1.53e Schneider et al., 2012 46 https://imagej.net/ij/list.html Ingenuity Pathway Analysis (IPA) QIAGEN https://digitalinsights.qiagen.com/ GraphPad Prism 8 GraphPad Software, San Diego, CA https://www.graphpad.com/ DAVID Bioinformatics Resources 6.8 LHRI (Huang et al., 2009) 47 https://david.ncifcrf.gov/ Gene Set Enrichment Analysis (GSEA) UC San Diego and Broad Institute (Subramanian et al., 2005) 48 https://www.gsea-msigdb.org/gsea/ index.jsp e5 Cell Reports Medicine 6, 102448, November 18, 2025 OPEN ACCESS immunotherapy (cetuximab-resistant group, n = 35), and (b) patients treated with immunotherapy without prior cetuximab exposure (cetuximab-naı̈ve group, n = 54). ..
|
AcceGen Biotechnology is a verified supplier 
AcceGen Biotechnology manufactures this product 